opuCA [2020-07-01 16:48:41]

glycine betaine/carnitine/choline/arsenobetaine/arsenocholine ABC transporter (ATP-binding protein)

Locus: BSU_33830

Isoelectric point: 6.55

Molecular weight: 43.09 kDa

Protein length: 380 aa

Gene length: 1143 bp

Function: compatible solute transport

Product: glycine betaine/carnitine/choline/arsenobetaine/arsenocholine ABC transporter (ATP-binding protein)

Essential: no

Synonyms: yvbE

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of compatible solutes for osmoprotection
• Information processing → Targets of second messengers → Targets of c-di-AMP
• Lifestyles → Coping with stress → Coping with hyper-osmotic stress
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,469,860 3,471,002

The protein

Catalyzed reaction/ biological activity

• uptake of glycine betaine, arsenocholine and arsenobetaine PubMed

Protein family

• ABC transporter superfamily (according to UniProt)

Paralogous protein(s)

• OpuAA, OpuBA

Domains

• ABC transporter domain (aa 2-236) (according to UniProt)
• 2 CBS domains (aa 255-314, aa 315-373) (according to UniProt)

Effectors of protein activity

• binds c-di-AMP, which likely inhibits uptake activity PubMed

Structure

• 2IT1 (from Pyrococcus horikoshii, 35% identity)
• 5KS7 (CBS domains from L. monocytogenes, with c-di-AMP bound) PubMed

Localization

• associated to the membrane (via OpuCB-OpuCD) PubMed

Expression and Regulation

Operons

• Genes: opuCA-opuCB-opuCC-opuCD
  Description: PubMed

  Regulatory mechanism

  • OpcR: repression, (sterical interference with RNA polymerase access) PubMed, in OpcR regulon
  • RemA: activation, PubMed, in RemA regulon
  • YlxR: regulation, PubMed, in YlxR regulon

  Regulation

  • induced by salt stress PubMed
  • induced in the absence of YlxR PubMed

Biological materials

Mutant

• BKE33830 (opuCA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATCCGTGCACCTCCGCAG, downstream forward: _UP4_TGACCAGGGGAGGAGCTCTT
• BKK33830 (opuCA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATCCGTGCACCTCCGCAG, downstream forward: _UP4_TGACCAGGGGAGGAGCTCTT

Expression vectors

• pGP2939 (N-terminal His-tag, purification from E. coli, in pWH844), available in Jörg Stülke's lab

References

Reviews

Loading

Original publications

Loading